Journal: Journal of Inflammation Research

Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

doi: 10.2147/JIR.S489087

Figure Lengend Snippet: The Different Expression of Key Genes in Renal Tubule Interstitium. Lupus Nephrities Samples versus Normal Samples

Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

Techniques: Expressing

Journal: Journal of Inflammation Research

Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

doi: 10.2147/JIR.S489087

Figure Lengend Snippet: The expression and diagnosis significance of IFI16, EGR1 and MX1 in LN. ( A ) IFI16 expression was distinctly upregulated in LN samples; ( C ) EGR1 expression was distinctly downregulated in LN samples; ( E ) MX1 expression was distinctly upregulated in LN samples. ( B / D / F ) Receiver operating characteristic (ROC) curves for IFI16, EGR1 and MX1 in LN. Normal samples n=35, LN samples n=91.

Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

Techniques: Expressing, Biomarker Discovery

Journal: Journal of Inflammation Research

Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

doi: 10.2147/JIR.S489087

Figure Lengend Snippet: Immune cell infiltration analysis of lupus nephrities. ( A ) Violin diagram of 22 types of immune cells between normal and LN specimens. Correlation of core genes IFI16 ( B ), EGR1 ( C ), MX1 ( D ) with infiltrating immune cells; the vertical ordinate represents the name of the immune cell and the abscissa represents the correlation coefficient; the circle size represents the absolute value size of the correlation coefficient.

Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

Techniques:

Journal: Journal of Inflammation Research

Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

doi: 10.2147/JIR.S489087

Figure Lengend Snippet: Renal pathology and expression of IFI204, EGR1 and MX1 in tubular epithelial cells in LN. ( A ) HE staining of control mice kidney tissue sections. ( B ) HE staining of MRL/lpr mice kidney tissue sections. ( C ) The protein of IFI204, EGR1 and MX1 levels were examined in protein extracts from tubular epithelial cells of MRL/lpr or C57BL/6 mice, and ( D-F ) RT-qPCR for the levels of mRNA levels of EGR1, MX1 and IFI204 of tubular epithelial cells isolated from MRL/lpr or C57BL/6 mice. All data were shown as mean ± SD.

Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

Techniques: Expressing, Staining, Control, Quantitative RT-PCR, Isolation

Journal: Journal of Inflammation Research

Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

doi: 10.2147/JIR.S489087

Figure Lengend Snippet: Expression of target protein in renal tubular with LN patients. Co-localisation of target proteins (pink) ( A) EGR1, ( B) IFI16 and ( C) MX1, F4/80 (red) (marker of macrophage), and Megalin (green) (marker of the renal tubules). DAPI was used for nuclear staining. LN, lupus nephritis; DAPI, 4′,6-diamidino-2-phenylindole.

Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

Techniques: Expressing, Marker, Staining

Journal: Journal of Inflammation Research

Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

doi: 10.2147/JIR.S489087

Figure Lengend Snippet: Expression of target protein in renal tubular within MRL/lpr. Co-localisation of target proteins (pink) ( A ) EGR1, ( B ): IFI204 and ( C ): MX1, F4/80 (red) (marker of macrophage), and Megalin (green) (marker of the renal tubules). DAPI was used for nuclear staining. LN, lupus nephritis; DAPI, 4′,6-diamidino-2-phenylindole.

Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

Techniques: Expressing, Marker, Staining